Please use this identifier to cite or link to this item:
https://www.arca.fiocruz.br/handle/icict/2412
Type
DissertationCopyright
Open access
Sustainable Development Goals
03 Saúde e Bem-EstarCollections
Metadata
Show full item record
IMPLEMENTAÇÃO DE UMA METODOLOGIA PARA GENOTIPAGEM DA REGIÃO PROMOTORA DO GENE DO TNF-A E SUA APLICAÇÃO EM UMA POPULAÇÃO EXPOSTA À SÍLICA
Occupational Exposure
Polymorphism, Genetic
Silicon Dioxide
Silicosis
Tumor Necrosis Factor-alpha
Occupational Health
Exposição Ocupacional
Polimorfismo Genético
Dióxido de Silício/toxicidade
Silicose/genética
Fator de Necrose Tumoral alfa/genética
Saúde do Trabalhador
Souza, Daniel Santos | Date Issued:
2010
Alternative title
Implementation of a method for genotyping the promoter region of TNF-a gene and its application in a population exposed to silicaAuthor
Comittee Member
Affilliation
Fundação Oswaldo Cruz. Escola Nacional de Saúde Pública Sergio Arouca. Rio de Janeiro, RJ, Brasil.
Abstract in Portuguese
A silicose é uma pneumoconiose provocada pela inalação da poeira de sílica e
consiste em uma lesão pulmonar com participação de citocinas como o Fator de
Necrose Tumoral alfa (TNF-α). Há dois polimorfismos nos sítios -238 e -308 do
promotor do gene da TNF-α (substituição de uma guanina por uma adenina) que têm
sido investigados como possíveis fatores de susceptibilidade para a silicose. A
mutação na posição -308 tem sido associada com altos níveis da citocina no sangue,
enquanto que a posição -238, com formas mais graves da doença. A exposição
ocupacional à sílica continua sendo um problema de Saúde Pública no Brasil. O
Centro de Estudos de Saúde do Trabalhador e Ecologia Humana
(CESTEH)/FIOCRUZ acompanha trabalhadores do Rio de Janeiro expostos à sílica.
Este trabalho teve como objetivo a implementação de uma metodologia para
determinação do polimorfismo dos sítios -308 e -238 do promotor da TNF-α para
futura utilização na avaliação da exposição à sílica. A genotipagem foi feita através
da técnica de PCR-RFLP (Polymerase Chain Reaction – Restricition Fragment Length
Polymorphism) usando NcoI para -308 e BamHI para -238. Foram realizados ensaios
para a implementação da metodologia, sendo esta aplicada em uma amostra
populacional de 79 trabalhadores assistidos no ambulatório do CESTEH, sendo todos
do sexo masculino e maiores de 18 anos. Como resultados foram fixadas as seguintes
condições (para ambos os sítios): 100ng de DNA extraído de 500µL de sangue total é
utilizado como molde para a PCR, junto com 1,5U de Taq-DNA Polimerase
Recombinante em um volume final de 50µL. Como primers, foram usados:
5'AGGCAATAGGTTTTGAGGGCCAT e 5'TCCTCCCTGCTCCGATTCCG como
senso e antisenso para -308 e 5'AAACAGACCACAGACCTGGTC e
5'CTCACACTCCCCATCCTCCCGGATC para -238. Os parâmetros da PCR para –
308 foram: 35 ciclos de 94ºC/40s, 60ºC/50s e 72ºC/60s, gerando um fragmento de
107pb; sítio –238: 35 ciclos de 94ºC/40s, 58ºC/90s e 72ºC/60s, gerando um fragmento
de 165 pb. Na digestão foi utilizada a proporção de 5U da enzima para cada 1µg de
DNA, sendo incubada a 37ºC por 1 hora. Os indivíduos com o alelo mutante perdem
o sítio atacado pela enzima de restrição. Os trabalhadores genotipados para o sítio -
308 apresentaram 16,4% (n=13) para o genótipo GA, 82,3% (n=65) para GG e 1,3%
(n=1) para o genótipo AA. O sítio –238 apresentou as frequências de 2,3% (n=2) para
GA, 97,7% (n=77) para GG e zero para AA. Nesse estudo, demonstrou-se que a
presença do alelo mutante (A) está associada a maiores quantidades da citocina no
sangue. Não foram encontradas diferenças significativas entre as médias da enzima
GST e a presença ou não do alelo mutante. A presença do alelo -308A apresentou
ainda um risco relativo de 3,697 para o desenvolvimento de silicose. A
implementação de um método toxicogenético permite a identificação de possíveis
determinantes de suscetibilidade individual ao desenvolvimento da doença,
aumentando o alcanço das avaliações da saúde do trabalhador.
Abstract
Silicosis is a pneumoconiosis caused by inhalation of silica dust and consists
of a lung injury with participation of cytokines, such as Tumor Necrosis Factor alpha
(TNF-α). There are two polymorphisms at sites -238 and -308 of the gene promoter in
TNF-α (replacement of a guanine-adenine), which have been investigated as possible
factors of susceptibility for silicosis. The mutation at position -308 has been
associated with high levels of cytokine in the blood, while at -238 with severe forms
of the disease. Occupational exposure to silica remains a public health problem in
Brazil. The Center for Studies on Workers' Health and Human Ecology (CESTEH) /
FIOCRUZ follows Rio de Janeiro's workers exposed to silica. This study aimed to
implement a methodology for determining the polymorphism of sites -308 and -238
of the promoter of TNF-α for future use in the assessment of exposure to silica.
Genotyping was made by PCR-RFLP (Polymerase Chain Reaction – Restricition
Fragment Length Polymorphism) using NcoI for -308 and BamHI for -238. Tests
were performed for implementing the methodology, which was applied in 79
employees assisted by CESTEH, all male and aged over 18. After the tests, the
following conditions were fixed for both sites: 100ng of DNA, extracted from 500µL
of whole blood, were used as template for PCR with 1.5 U of Taq-DNA Polymerase
Recombinant and a final volume of 50µL. The primers were:
5'AGGCAATAGGTTTTGAGGGCCAT and 5'TCCTCCCTGCTCCGATTCCG as
sense and antisense to -308 and 5'AAACAGACCACAGACCTGGTC and
5'CTCACACTCCCCATCCTCCCGGATC to -238. The PCR parameters for -308 site
were: 35 cycles using 94ºC/40s, 58ºC/90s and 72ºC/60, generating a fragment of 107
pb. The PCR parameters for -238 site were; 35 cycles using 94ºC/40s, 58ºC/90s and
72ºC/60s, generating a fragment of 165 pb. The digestion was made with 5U of
endonuclease for 1mg of DNA incubated at 37°C for 1 hour. Individuals with the
mutant allele lose the site which is attacked by the restriction enzyme. Workers
genotyped for the -308 site showed 16.4% (n = 13) for the GA genotype, 82.3% (n =
65) for GG and 1.3% (n = 1) for the genotype AA. The -238 site showed the
frequencies of 2.3% (n = 2) for GA, 97.7% (n = 77) for GG and zero for AA. This
study shows that the presence of the mutant allele (A) is associated with greater
amounts of cytokine in the blood. There were no significant differences between the
means of the enzyme GST and the presence of the mutant allele. The presence of the
-308 mutant allele also showed a relative risk of 3,697 for the development of
silicosis. The implementation of a toxicogenetic method allows the identification of
possible determinants of individual susceptibility to disease development, increasing
the reach of the evaluations of occupational health.
Keywords
Air Pollutants, OccupationalOccupational Exposure
Polymorphism, Genetic
Silicon Dioxide
Silicosis
Tumor Necrosis Factor-alpha
Occupational Health
DeCS
Poluentes Ocupacionais do Ar/toxicidadeExposição Ocupacional
Polimorfismo Genético
Dióxido de Silício/toxicidade
Silicose/genética
Fator de Necrose Tumoral alfa/genética
Saúde do Trabalhador
Share